Short Article Regulation of Mother-to-Offspring Transmission of Highlights d Wild-type mtDNA heteroplasmy is sensed in oocyte maturation and embryo development d Random versus selective mtDNA segregation is driven by the nuclear genetic context d Haplotype-derived OXPHOS differences and ROS signaling define the preferred mtDNA d Efficiency of iPSC generation strongly depends on themtDNA Authors Ana Latorre-Pellicer, Ana Victoria Lechuga-Vieco, Iain G. Johnston, ..., Nick S. Jones, Jesu´s Ruı´z-Cabello, Jose´ Antonio Enrı´quez Correspondence jaenriquez@cnic.esLatorre-Pellicer et al., 2019, Cell Metabolism 30, 1–11 November 5, 2019 Crown Copyright ª 2019 Published by Elsevier Inc. https://doi.org/10.1016/j.cmet.2019.09.007haplotypeGraphical AbstractmtDNA HeteroplasmyIn Brief The dynamics of heteroplasmic mtDNA populations and the factors that promote mtDNA homogeneity remain poorly understood. Latorre-Pellicer et al. have discovered that heteroplasmy is checked at oocyte maturation and in the early embryo. mtDNA segregation can occur on a spectrum from randomdrift to strong selection of one of the haplotypes, through mechanisms dependent upon mito-nuclear interactions affecting embryo metabolism and cell fitness. Cell Metabolism Short Article Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy Ana Latorre-Pellicer,1,2,12 Ana Victoria Lechuga-Vieco,1,3,12 Iain G. Johnston,4 Riikka H. H€am€al€ainen,5,6 Juan Pellico,1,3 Raquel Justo-Me´ndez,1 Jose Marı´a Ferna´ndez-Toro,1 Cristina Claverı´a,1 Adela Guaras,1 Rocı´o Sierra,1 Jordi Llop,7,8 Miguel Torres,1 Luis Miguel Criado,1 Anu Suomalainen,6 Nick S. Jones,9 Jesu´s Ruı´z-Cabello,3,7,8,10 and Jose´ Antonio Enrı´quez1,11,13,* 1Centro Nacional de Investigaciones Cardiovasculares Carlos III, Madrid, Spain 2Unit of Clinical Genetics and Functional Genomics, Department of Pharmacology-Physiology, School of Medicine, University of Zaragoza, ISS-Aragon, 50009 Zaragoza, Spain 3CIBERES: C/ Melchor Ferna´ndez-Almagro 3, 28029 Madrid, Spain 4School of Biosciences, University of Birmingham, Birmingham, UK 5Department of Neurobiology, A.I. Virtanen Institute for Molecular Sciences, University of Eastern Finland, Kuopio, Finland 6Research Program of Molecular Neurology, Biomedicum, University of Helsinki, Helsinki, Finland 7CIC biomaGUNE, Paseo Miramo´n No 182, San Sebastia´n, 20014 Guipu´zcoa, Spain 8IKERBASQUE, Basque Foundation for Science, Bilbao, Spain 9Department of Mathematics, Imperial College London, London SW7 2BB, UK 10Universidad Complutense de Madrid, Madrid 28606, Spain 11CIBERFES: C/ Melchor Ferna´ndez-Almagro 3, 28029 Madrid, Spain 12These authors contributed equally 13Lead Contact *Correspondence: jaenriquez@cnic.es https://doi.org/10.1016/j.cmet.2019.09.007 SUMMARY mtDNA is present in multiple copies in each cell derived from the expansions of those in the oocyte. Heteroplasmy, more than one mtDNA variant, may be generated by mutagenesis, paternal mtDNA leakage, and novel medical technologies aiming to prevent inheritance of mtDNA-linked diseases. Het- eroplasmy phenotypic impact remains poorly under- stood. Mouse studies led to contradictory models of random drift or haplotype selection for mother-to- offspring transmission of mtDNA heteroplasmy. Here, we show thatmtDNA heteroplasmy affects em- bryo metabolism, cell fitness, and induced pluripo- tent stem cell (iPSC) generation. Thus, genetic and pharmacological interventions affecting oxidative phosphorylation (OXPHOS) modify competition among mtDNA haplotypes during oocyte develop- ment and/or at early embryonic stages. We show that heteroplasmy behavior can fall on a spectrum from random drift to strong selection, depending on mito-nuclear interactions and metabolic factors. Understanding heteroplasmy dynamics and its mechanisms provide novel knowledge of a funda- mental biological process and enhance our ability to mitigate risks in clinical applications affecting mtDNA transmission. INTRODUCTION Mitochondrial DNA (mtDNA) exists in populations within eukary- otic cells and encodes genes that are vital for cellular energetics and metabolism. Cellular populations of mtDNA may be geneti- cally identical (homoplasmy) or consist of a genetic admixture (heteroplasmy) arising from mutation, inheritance, or gene thera- pies. The interaction between different variants of mtDNA within the samecytoplasm is a fascinating biological problemwith evolu- tionary, physiological, pathological, and ethical implications. It has Context and Significance Normally, one single version of mtDNA is present in a cell. Recent observations indicate that more than one mtDNA variant would be present in the same cell (heteroplasmy). Latorre-Pellicer et al. have investigated this phenomenon across gener- ations in mice harboring two versions of mtDNA. During early embryo development and oogenesis, the cell can detect the mtDNA variants and selectively expand one of them until it becomes predominant. The selection process is dependent upon specific nuclear-encoded genes and their interaction with mitochondrial genes. This information on the regulation of heter- oplasmymay be used to prevent the transmission of mtDNA-linked diseases and to better designmedical technologies that involve mitochondrial transfer from a donor. Cell Metabolism 30, 1–11, November 5, 2019 Crown Copyright ª 2019 Published by Elsevier Inc. 1 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 come to the forefront of public awareness due to debate concern- ing the use of mitochondrial replacement therapy in human oocytes to prevent transmission of mtDNA-linked diseases (Tachibana et al., 2009; Craven et al., 2010), and the proposal to improve fertility by injecting young donor oocyte cytoplasm and mtDNA to oocytes of sub-fertile women (Woods and Tilly, 2015). However, the dynamics of heteroplasmic mtDNA populations and the factors that affect these dynamics remain poorly understood. In mammals, mtDNA encodes a reduced number of genes: 13 mRNAs, 22 tRNAs, and 2 rRNAs. All proteins encoded in the mtDNA are structural components of the multiprotein mitochon- drial respiratory complexes. It is critical that these mtDNA-en- coded proteins match physically and functionally with up to 70 nDNA-encoded structural proteins of the same complexes to build a functional oxidative phosphorylation (OXPHOS) system. Animal models with identical nuclear genomes but with different mtDNA haplotypes (conplastic mice) generate functionally different OXPHOS systems that shape organismal metabolism (Latorre-Pellicer et al., 2016), supporting the conclusion that different wild-type mtDNA variants have phenotypically impor- tant consequences. Selection between non-pathological mtDNA haplotypes in the female germline of heteroplasmic engineered mice was first thought not to exist (Jenuth et al., 1996), but this conclusion has been recently questioned (Burgstaller et al., 2014; Sharpley et al., 2012). Solving this dispute is ofmajor interest in addressing the potential medical implications of mixed mtDNA populations. The analysis of mtDNA heteroplasmy progression in genetically manipulated monkey heteroplasmic oocytes revealed that, dur- ing embryo development, one of the mtDNA variants may become predominant (Lee et al., 2012). In human embryonic stem cells (ESCs) derived from embryos cultured in vivo after nuclear transfer to exchange mtDNA complements, similar expansion of the residual mtDNA haplotype has been observed (Kang et al., 2016; Yamada et al., 2016). Very recently, expansion of the minority copies of paternal mtDNA (70 versus 200,000) was documented in human families where the active elimination of the sperm mitochondria failed (Luo et al., 2018). The driving forces responsible for the selective advantage of mtDNA during embryo development is still unknown. Here, we address these questions by elucidating mtDNA behavior between non-pathological mtDNA variants in unprece- dented detail in a set of novel model organisms. We identify stages at which mtDNA haplotype selection occurs during early embryo development and a set of metabolic and nuclear genetic factors that drive this selection. RESULTS mtDNA Competition at Early Embryonic Stages We generated heteroplasmic mice by electro-fusion of an em- bryo and an enucleated embryo. The nuclear genome from C57BL/6JOlaHsd strain was combined with mtDNA either of NZB/OlaHsd (BL/6NZB) or of C57BL/6JOlaHsd (BL/6C57). The heteroplasmic offspring (named BL/6C57-NZB) were mated with C57BL/6JOlaHsd males to prevent nuclear genetic drift in our particular mice strains. We did not observe any adverse effect of the heteroplasmy in ovary, embryo development, or fertility (Figures S1A and S1B). Only the offsprings of the established heteroplasmic mice were used. During female germline maturation, mtDNA undergoes a ge- netic bottleneck where random drift and positive selection may both act to strongly reduce heteroplasmy in cells (Johnston et al., 2015). A parallel assessment of heteroplasmy in gonads (ovary and testis) and in germline cells revealed that both oo- cytes and spermatozoa progressively select for C57 mtDNA with age despite their rather dissimilar differentiation process (Figures 1A and 1B). Oocytes are the cells with the highest mtDNA content, up to 200,000 copies per cell (Piko´ and Taylor, 1987), while sperm mtDNA content is among the lowest (70 copies per cell) (Dı´ez-Sa´nchez et al., 2003). Whole-ovary analysis also showed a significant tendency to accumulate C57 mtDNA while testes accumulated NZB mtDNA (Figures 1A and 1B). Therefore, the mtDNA extracted from ovaries is a good proxy of the behavior of the oocyte mtDNA heteroplasmy, whereas the analysis of testis cannot inform us about the sperm mtDNA heteroplasmy. How does this selection of C57 mtDNA in ovaries occur? In fetal stage, during early oogenesis, there is a substantial in- crease in mtDNA copy number (10 to 20 times [Wai et al., 2008]). Post-natal maturation of the oocytes for ovulation re- quires a further mtDNA replication activity with a burst in mtDNA copy number (Johnston et al., 2015; Wai et al., 2008). Analysis of the ovary at different ages of the mother showed that the mtDNA haplotype (C57 or NZB) modifies the proportion of follicles at different stages of maturation, with a better maintenance of the ovary function with NZB mtDNA. In particular, the proportion of primordial follicles at early age is increased in the presence of NZB mtDNA with respect to that shown in homoplasmic C57 mtDNA (Figure S1C). Heteroplasmy induces an accelerated loss of primary oocytes (Figure S1C). This loss may suggest either a selection against subpopulations of follicles with higher proportion of NZB mtDNA or, alternatively, an earlier maturation of oocytes with higher content of NZB mtDNA. However, addi- tional mtDNA intracellular selection within oocytes with age can also occur. Either scenario could explain the shift in hetero- plasmy toward more C57mtDNAwith the age of the mother. Wai and Shoubridge (Wai et al., 2008) reported a significant increase in NZB mtDNA in more mature oocytes when studying hetero- plasmy dynamics (Balb/c versus NZB mtDNA haplotypes) be- tween primary follicles and secondary follicles (between post- natal day 1 and post-natal day 29), but this observation cannot rule out the alternative explanations. Moreover, the analysis of over 900 pups reveal that the C57 mtDNA is significantly favored, with a 45:1 proportion of homoplasmic C57 versus NZB (Figure 1C). Based on these heteroplasmy changes observed in ovaries, the intergenerational heteroplasmy shift between mother and offspring (measured by comparing tail measurements at day 21) was predicted to increase with the mother’s age at pup birth. Our observations indeed indicate a selective segregation in favor of C57 mtDNA haplotype from heteroplasmic mothers to pups (Figure 1C). However, the female germline segregation inferred through ovary mtDNA dynamics cannot account in full for the observed mother-to-pup shift in mtDNA heteroplasmy (Fig- ure 1C), suggesting that additional selection in favor of C57 mtDNA haplotype takes place during gestation. 2 Cell Metabolism 30, 1–11, November 5, 2019 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 Pursuing this observation, we found that a very fast shift in het- eroplasmy happened during early development between 2.5 and 5.5 days post-coitum (dpc), which includes the implantation and pre-gastrula post-implantation stages (Figure 1D). No evidence of selection could be observed between 5.5 and 13.5 dpc embryos (Figures 1D, 1E, and S1D). At 17.5 dpc, heart and brown adipose tissue (BAT) revealed selection in favor of C57 and NZB mtDNAs respectively (Figures 1F and S1D). Interestingly, placenta did not show any mtDNA haplotype preference at any stage. In summary,mother-to-pup development of heteroplasmy has dual contributions, both from positive selection for C57 in devel- oping oocytes and additional positive selection in early embryo- genesis. This dual selection mirrors the dynamics observed in another heteroplasmic mouse model (Burgstaller et al., 2018). Heteroplasmy Alters Metabolism of Mouse Embryonic Fibroblast and of the Embryo We next asked whether metabolic factors may be responsible for these mtDNA selection patterns. Recently, we demonstrated that the two mtDNA variants (NZB or C57) determine qualitatively different OXPHOS performance in mice (Latorre-Pellicer et al., 2016), confirming our previous observations in cybrid cell lines (Moreno-Loshuertos et al., 2006). To investigatewhether suchvar- iations in OXPHOS function influence mtDNA haplotype segrega- tion, we isolated mouse embryonic fibroblasts (MEFs) from post- implantation embryos of the homoplasmic strains, BL/6C57 and BL/6NZB, and from heteroplasmic mice, BL/6C57-NZB, with three different proportions of heteroplasmy (Figure 2). To guarantee that they were true heteroplasmic cells and not a mix of cells withdifferentmtDNAs, heteroplasmywasassessedusingpadlock probes to detect in situ each mitochondrial DNA haplotype by confocal fluorescencemicroscopy. In thisway,wecould conclude that heteroplasmy is intracellular and not intercellular (Figure 2A), as both mtDNA variants co-exist in the same cytoplasm. Interestingly, heteroplasmic MEFs showed a consistent reduction in basal andmaximum respiration capacity, regardless of the proportion of heteroplasmy and the carbon source (Fig- ures 2B and 2C). The presence of any level of heteroplasmy A B D F C E Figure 1. Heteroplasmy Is Sensed and mtDNA Segregated Prenatally (A) Convergence in heteroplasmic proportions between ovary (red, p = 1.2 3 104 against zero segregation) and oocytes (blue, p = 3.7 3 104 against zero segregation) (n = 110 oocytes and n = 13 ovaries from 13 BL/6C57-NZB females). (B) Divergence in the heteroplasmic proportion between testis (red, p = 7.6 3 106 against zero segregation) and spermatozoa (blue, p = 1.53 104 against zero segregation) (n = 18). In (A) and (B), the candlesticks show heteroplasmy statistics amalgamated over time, compared to a zero-change null hypothesis. (C) Heteroplasmy shift between mother’s tail sampled at 21 days old and pup’s tail sampled at 21 days old (vertical axis), as a function of the mother’s age when the pup was born (horizontal axis). Red lines show a fit, with 95% CI, to a linear decrease in transformed heteroplasmy (STAR Methods) with mother’s age. Black line shows the predicted trend from the inferred developmental shift and ovarian segregation; alone, it cannot explain the observed shift in heteroplasmy between mothers and their offspring (pups = 819 from 43 BL/6C57-NZB females, ovary = 73 from BL/6C57-NZB females). (D) Shifts in heteroplasmy, relative to ovary het- eroplasmy, observed upon a change into each pluripotency class. The classes are 0 (ovary, n = 73), I (oocyte, n = 110), II (2.5 dpc embryos, n = 101), III (5.5 dpc embryos, n = 21, p = 1.03 1013 against zero segregation, p = 4.7 3 106 against identity to II), and IV (13.5 dpc embryos, n = 161, p = 3.0 3 109 against zero segregation). Pink dots represent heteroplasmy level in the indi- cated embryo class samples, and blue dots represent heteroplasmy in iPSCs derived from MEF lines stablished from class IV embryos. Heteroplasmy changes are tested against a zero-change null hypothesis, and between classes. (E and F) Variability in heteroplasmy between embryos of the same litter at 13.5 (n = 9) (E) or 17.5 dpc (n = 10) (F) and between the indicated tissues. In (A)–(C), (E), and (F), transformed heteroplasmy shift using tail as the reference tissue. In (E) and (F), comparisons assessed by Mann-Whitney test and one- way ANOVA; Tukey’s range test correction for multiple comparison (*p < 0.05; **p < 0.01; ***p < 0.001). Cell Metabolism 30, 1–11, November 5, 2019 3 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 BD E F C G J K H I A (legend on next page) 4 Cell Metabolism 30, 1–11, November 5, 2019 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 induced elevatedmitochondrial membrane potential (MMP) (Fig- ure 2D) and higher reactive oxygen species (ROS) production (Figure 2E), one order of magnitude higher than the homoplasmic MEFs when normalized by the maximum respiration rate (MRR) (Figure 2F). We further observed that these functional conse- quences feed back onto the dynamics of mtDNA populations. MEFs maintained heteroplasmy levels when grown in glucose over-rich medium, whereas they favored NZB mtDNA at physio- logical concentrations of glucose and shifted toward C57mtDNA in amedium promoting OXPHOS, when glucose was substituted by galactose (Figures 2G and S1E). Following these observations, we asked whether these meta- bolic impacts of heteroplasmy in cultured MEFs reflected similar impacts in vivo. We investigated the metabolic poise of 12.5 dpc embryos by determining their ability to uptake 18F-Fluorodeoxy- glucose ([18F]-FDG) or 18F-Fluoromisonidazole ([18F]-FMISO) us- ing positron emission tomography and computed tomography (PET-CT). In addition, we quantified the uptake of the probes by gamma counter in isolated embryos. In this way, we could estimate the embryo glucose demands ([18F]-FDG) and oxygen utilization in correlation with their heteroplasmy proportion. Notice that the ([18F]-FMISO) is an inverse indicator of oxygen consumption since the signal increase in hypoxic status (Grimes et al., 2017; Corroyer-Dulmont et al., 2015; Warren and Par- tridge, 2016). We found that glucose uptake is decreased (Fig- ures 2H and S1F) and oxygen level higher (Figures 2I, S1G, and S1H) when NZB mtDNA predominates (Figure S1H; 100% NZB mtDNA). This observation in the embryo is reminiscent of our previous results showing that NZB and C57 mtDNAs pro- mote differential organismal metabolism (Latorre-Pellicer et al., 2016). The PET-CT analysis indicates that the energetic meta- bolism of the embryos, with high glycolytic predominance, can be modulated between more oxidative versus more glycolytic metabolism (Figures 2H, 2I, and S1H). We next sought to characterize the influence of mtDNA popu- lation structure on metabolic poise at a finer-grained, molecular scale. To this end, we isolated 12.5 dpc embryos from the homo- plasmic and heteroplasmic strains and analyzed the organization of the mitochondrial electron transport chain by blue native elec- trophoresis (BNE). We found that the CI + CIII2/CI ratio is decreased in homoplasmic NZB animals with respect to homo- plasmic C57 (Figure 2J). We described elsewhere that in most C57BL/6 tissues, respiratory complex I is mainly distributed be- tween the free monomer CI and the super-assembled CI + CIII2 (Cogliati et al., 2016). We also showed that the relative ratio of CI + CIII2/CI is adapted by the mitochondria according to avail- able fuel, being higher when glutamate or pyruvate is the main source of electrons and reduced when fatty acids are the pre- dominant source (Guara´s et al., 2016). The substitution of C57 by NZB haplotype in homoplasmic animals induced a shift in the fuel use by mitochondria in adult liver and also reduces the CI + CIII2/CI ratio (Latorre-Pellicer et al., 2016). In heteroplasmic embryos, we observed an exacerbated decrease in the CI + CIII2/CI compared to homoplasmic NZB embryos (Figure 2J). Looking at another molecular-scale readout of metabolic poise, we next assessed the relative contribution of glycolytic versus oxidative ATP production in the embryos by determining the bioenergetic cellular (BEC) index (Cuezva et al., 2004). The BEC index is calculated by the estimation of the ratio of expres- sion between the beta subunit of the mitochondrial H+-ATP syn- thase and a critical protein of the glycolysis (GAPDH) by western blot. This index was decreased in heteroplasmic versus homo- plasmic embryos suggesting, as it was observed in MEFs, that heteroplasmy impacts on the mitochondrial OXPHOS efficiency (Figure 2K). Thus, once more, we find that the presence of heteroplasmy has a qualitatively different effect on the metabolic poise of MEFs and embryos than would be expected as a simple combi- nation of homoplasmic contributions. Embryonic mtDNA Segregation Is Associated with Pluripotency Despite the metabolic impact of mtDNA heteroplasmy on MEFs and embryos during gestation, dynamic changes in hetero- plasmy seem largely restricted to a short period in early develop- ment. Since the observed stages of the segregation coincide with the appearance of pluripotency in the embryo epiblast, we decided to study the relationship between mtDNA heteroplasmy and pluripotency. We generated induced pluripotent stem cells (iPSCs) from BL/6C57, BL/6NZB, and heteroplasmic BL/6C57-NZB MEFs in order to reprogram their differentiation status toward pluripotency. Interestingly, cultured BL/6C57-NZB iPSCs strongly selected against NZB mtDNA (Figure 3A). Unexpectedly, we noticed a significant decrease in the reprogramming efficiency Figure 2. Heteroplasmy Modulates MEF and Embryonic Metabolism (A) Identification of C57 and NZB mtDNA haplotypes in MEFs by in situ fluorescence. In blue is labeled the nucleus; in green, mtDNA C57; in red, mtDNA NZB. (B–F) Metabolic performance of MEFs derived from 12.5 dpc embryos of homoplasmic or heteroplasmic mice. Heteroplasmy indicates % of NZB mtDNA. Oxygen consumption rate (OCR) of intact cells estimated by SeaHorse at (B) 5mMglucose and (C) 5mMgalactose. (D) Mitochondrial membrane potential and (E) H2O2 production per cell or (F) per maximum respiration (OCR) capacity. (G) Dynamics of mtDNA segregation in MEFs under different nutritional conditions: 25 mM glucose displays no segregation (right); 5 mM glucose displays linear segregation (left); galactose shows significant support for a model where there is no heteroplasmy change in early treatment, followed by fast decrease after 21 days (center, likelihood ratio test, p < 0.05) (n = 3 BL/6C57-NZB immortalizedMEF lines per treatment during 62 days of culture. Initial heteroplasmy levels: 43, 46, and 47% of NZB mtDNA respectively). (H and I) Determination of [18F]-FDG (H) or [18F]-FMISO (I) uptake measured by gamma counter in 12.5 dpc embryos with different degrees of heteroplasmy. Each dot represents an individual embryo; colors indicate embryos from the same litter. (J) BNE showing the assembly and superassembly status of respiratory complexes in the indicated 12.5 dpc embryos (left) and the proportion of the CI su- perassembly status (right) (n = 3 homoplasmic embryos and n = 4 heteroplasmic embryos). (K) Western blot (top) and metabolic BEC index (ATPB/GADPH) quantification (bottom) of the relative proportion of glycolytic versus oxidative capacity in the indicated embryo strains (n = 5 homoplasmic embryos and n = 8 heteroplasmic embryos) (mean ± SD, one-way ANOVA test, *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). See Tables S1 and S2 for antibodies utilized in western blot and padlock probes, respectively. Cell Metabolism 30, 1–11, November 5, 2019 5 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 of MEFs obtained from conplastic BL/6NZB and heteroplasmic BL/6C57-NZB animals when compared with MEFs from BL/6C57 mice (Figures 3B and 3C). These results are in agreement with a theoretical study elucidating the dependence of pluripotency on mitochondrial status (Johnston et al., 2012) and resemble what was reported for mutator mice that carry a load of mtDNA heteroplasmy (H€am€al€ainen et al., 2015). Moreover, we observed that NZB mtDNA was preferentially lost upon reprogramming of BL/6C57-NZB MEFs (Figure 3D). Using culture conditions with 4% oxygen, the reprogramming efficiency increased in MEFs regardless of their mtDNA content, but oxygen concentration did not prevent the heteroplasmic shift (Figures 3B and 3D). We demonstrated elsewhere that the primary difference induced by the interchange of the mtDNA haplotypes NZB and C57 is the higher ROS signaling generated by NZB mtDNA (La- torre-Pellicer et al., 2016; Moreno-Loshuertos et al., 2006). Here, we found that heteroplasmic MEFs generate high levels of ROS (Figures 2E and 2F). To pursue the potential role of ROS in reprogramming, we generated iPSCs in the presence of 1 mM N-acetyl-L-cysteine (NAC), an antioxidant and reduc- tant. We found that reprogramming efficiency increased signifi- cantly in MEFs derived from BL/6NZB and BL/6C57-NZB embryos without affecting that of BL/6C57 MEFs (Figures 3B and 3C). Moreover, the presence of NAC eliminated the heteroplasmic shift during MEFs to iPSCs reprogramming (Figure 3D). Overall, this behavior is reminiscent of the observed reduction in iPSCs reprogramming efficiency associated with elevated mitochon- drial ROS and the demonstration of negative selection against mutant mtDNA by pluripotent stem cells (H€am€al€ainen et al., 2015). Remarkably, per-oral NAC treatment provided to the BL/6C57-NZB pregnant females in their drinking water abolished the observed early embryonic shift in heteroplasmy (Figure 3E). In the presence of NAC, the mtDNA selection during oocyte maturation can account in full for the heteroplasmic shift between the mother and pups (Figure 3E). These results suggest that mtDNA haplotype has a substantial effect on reprogramming efficiency and pluripotency of cells, which likely manifest at least in part by levels of ROS production, and reminiscent of the above feedback loops, the differentiation process places selective pressure on cellularmtDNA populations. D E BA C Figure 3. Heteroplasmy Modulates Pluripotency (A) Left: heteroplasmy shift between themean of theMEF set and individual derived iPSCs, showing a significant departure from zero (n = 80 iPSCs clones from 4 different MEFs BL/6C57-NZB lines, p = 1.43 1011 against zero segregation). Heteroplasmy change with iPSC passage, with the heteroplasmy of the first passage as the reference value, and the x axis labeling subsequent passages (n = 8 iPSCs BL/6C57-NZB lines); lines show mean linear fit and 95% CI. (B) iPSC reprogramming efficiency of BL/6C57, BL/6NZB, and BL/6C57-NZB MEFs under 21%O2 (n = 7 per genotype), 21%O2 (n = 4 per genotype) plus 1mMNAC, and 4% O2 (n = 4 per genotype) (mean ± SD, two-tailed t test, *p < 0.05; **p < 0.01; ***p < 0.001). (C) Alkaline phosphatase (AP) staining of iPSC colonies 14 days after transposon-mediated gene transfer. (D) Heteroplasmy shift between the mean of the MEFs set and individual MEFs, individual iPSCs reprogrammed under 21%O2 (n = 50 iPSC clones), 21%O2 plus 1 mM NAC (n = 45 iPSC clones), and 4% O2 (n = 9 iPSC clones) (mean ± SD, ANOVA test, *p < 0.05; **p < 0.01). (E) Heteroplasmy shift betweenmother and pups for mice treated with NAC. Red lines show the fit to a linear decrease in transformed heteroplasmy withmother’s age from untreated animals (control mean andCI obtained from Figure 1C data points). Blue lines show a fit with 95%CI to the heteroplasmy shift betweenmother tail at 21 dpc and pups at 21 dpc with NAC administration in drinking water tomother during gestation (n = 52 pups from 9 BL/6C57-NZB females treated with NAC). 6 Cell Metabolism 30, 1–11, November 5, 2019 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 Embryonic mtDNA Segregation Is Determined by Nuclear-Mitochondrial Interaction All the studies on mtDNA segregation performed in mouse models use inbred strains that are homozygotic for most of their nuclear genes. This situation is rather unnatural: in every generation, maternally transmitted mtDNA is confronted with new nuclear alleles that offer novel variability in nuclear-encoded mitochondrial genes from the father. To translate our observa- tions into a more realistic situation, we bred heteroplasmic females with NZB/OlaHsd males to induce heterozygosity in the first generation of heteroplasmic animals. Strikingly, the induction of heterozygosity markedly reduces the observed embryonic selection toward C57 mtDNA (Figure 4A). To investigate the mechanism behind this mito-nuclear inter- action, we next focused on specific genes known tomildly influ- ence mitochondrial performance that can differ between NZB/OlaHsd and C57BL/6 strains: supercomplex assembly factor 1 (SCAF1 or Cox7a2l) and the nicotinamide nucleotide transhydrogenase (NNT). SCAF1 is required for the superas- sembly between complexes III and IV of the mitochondrial elec- tron transport chain (Cogliati et al., 2016), and it is mutated in all C57BL/6 sub-strains, which have lost this capacity without ma- jor effects on health or fertility (Lapuente-Brun et al., 2013). NNT is an integral mitochondrial inner membrane enzyme that couples the hydride transfer between NAD(H) and NADP(+) to proton translocation across the inner membrane to produce NADPH in the mitochondrial matrix. NNT is needed for biosyn- thetic processes and free radical detoxification. The C57BL/6J sub-strain naturally lacks functional NNT. Despite this, the an- imals are healthy and fertile but lose versatility in the proper adaptation of OXPHOS to environmental changes and may develop some minor impairments (Picard et al., 2015). The NZB/OlaHsd strains harbor thewild-type version of both genes, while our heteroplasmic animals harbor the mutant version of SCAF1 and the wild-type version of the NNT. Finally, we also considered nuclear factors controlling mitochondrial dynamics. Mitochondrial fission is related to autophagy and removal of mitochondria via mitophagy and hence can shape the genetic structure of cellular mtDNA populations (Shirihai et al., 2015). Tissue-specific response to mtDNA segregation in heteroplas- mic mice with mutated dynamin-related protein 1 (DRP) involved in mitochondrial fission has been reported (Jokinen et al., 2016). Other fusion proteins (i.e., MFN1, MFN2, and OPA1) may play a crucial role in mtDNA nucleoids segregation (Carelli et al., 2015). It is possible that functional variations in these (and/or other) genes could impact mitochondrial func- tion and influence mtDNA segregation during germline transmission. A C D B Figure 4. MtDNA Haplotype Competition in Oocyte Biogenesis and Embryo Development Are Determined by Nuclear Context (A) Mother-to-pup heteroplasmic shift in the inbred (homozygote) C57BL/6 nuclear background (data from Figure 1C), compared with the F1 of BL/6C57-NZB females with NZBNZB males to generate a non-inbred (heterozygote) background. Each dot corresponds to a different individual. (B) Evaluation of ovary heteroplasmywith the age of themother in heteroplasmic females with alterations in the indicated nuclear geneswith respect to the original heteroplasmic animal (see Figure 1A). Each dot represents the heteroplasmy shift of the ovary from a different female. (C) Comparative behavior of the mother-to-pup heteroplasmic shift with the age of the mother in heteroplasmic strains, with alterations in the indicated nuclear genes. Each dot corresponds to a different individual. (A–C) Significant non-zero slope, linear regression, *p < 0.05, **p < 0.01, ***p < 0.001. (D) Heteroplasmy development between pluripotent classes 0 (ovary) and III (5.5–6.5 dpc embryos) in heteroplasmic lines with alterations in the indicated nuclear genes (mean ± SD, two-tailed t test, *p < 0.05). Eye and tail were used as the reference tissues to calculate the heteroplasmy shift. Cell Metabolism 30, 1–11, November 5, 2019 7 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 To explore the interplay between these processes and mtDNA population structure, we generated three novel heteroplasmic mousemodels to assess the relative relevance for mtDNA segre- gation of (1) the relevance of ROS signaling/detoxification (NNTKOmice), (2) the role of the superassembly of the respiratory complexes (SCAF1113 mice), or (3) the mechanism of fragmenta- tion and removal of damaged mitochondria under stress (OMA1KO mice). First, we evaluated whether variability in these nuclear genes impacts on the previously observed segregation of mtDNA in ovary with the age of the mother. Comparison between each ge- notype with the control heteroplasmic group showed that the three different nuclear modifications alter the original segrega- tion toward C57 mtDNA in ovaries with age (compare Figure 1A with Figure 4B). Thus, BL/6C57-NZB:NNTKO and BL/6C57-NZB:OMA1KO showed no segregation preference, while BL/6C57-NZB:SCAF1113 shifted their preference from C57 toward NZB mtDNA. Next, we evaluated if variability in these nuclear genes impacts themother-to-pup transmission of heteroplasmy. For that, tail heteroplasmic levels of the mothers from different strains were measured at the time of weaning. In agreement with the lack of preferences in ovary (Figure 4B), the ablation of NNT or OMA1 erased the preference toward C57 mtDNA during mother-to-pup transmission observed in the control heteroplas- mic animals (compare Figure 1C with Figure 4C). Surprisingly, the tendency to favor NZB in ovaries induced by the re-expres- sion of SCAF1 was fully reverted in mother-to-pup transmission, which again showed a preference in favor of C57 mtDNA (Fig- ure 4C). The coherence between the lack of preferential segrega- tion in ovary and mother-to-pup strongly suggests that the observed phenomenon of embryonic segregation was also lost when NNT or OMA1 genes are ablated. In fact, no changes in the heteroplasmic proportions between ovary and 6.5 dpc em- bryos could be detected (Figure 4D). On the other hand, the change in preferred mtDNA in ovary (NZB instead of C57) in mother-to-pup shown in SCAF1113 animals predicts that the embryo-stage segregation in favor of C57 mtDNA should be strong. In agreement with this prediction, we found that the heteroplasmic proportion between mother ovary and 6.5 days embryos in SCAF113 animals experiences a drastic shift toward C57mtDNA haplotype, indicative of a strong mtDNA selection during early embryo development. DISCUSSION We have shown here that intergenerational wild-type mtDNA haplotype selection is common and depends on the impact of the mtDNA haplotype on the performance of the OXPHOS sys- tem.We described that in addition to themtDNA selection during female germline maturation, a second step of mtDNA selection happened at early embryonic stages. Fuel preference, mito- chondrial dynamics regulation, and differential mitochondrial ROS handling all play a substantial role in the driving force of the selection. This dependence helps to resolve one of the his- toric debates on the topic of mtDNA selection: under a variety of different circumstances, which we reveal and quantify, different degrees of mtDNA selection (including none) may be observed. Together, these observations reflect that the commu- nication between mtDNA and the nuclear genome determines the dynamics of cellular mtDNA populations: selection of one or other of the haplotypes or no selection at all. Our data provide an explanation for apparently conflicting conclusions resulting from the diverse nuclear genotypes of the inbred mouse strains used (Jenuth et al., 1996; Sharpley et al., 2012). If wild-type mtDNA haplotype variability can cause sufficient functional differences to trigger segregation, it is expected that overtly pathological haplotypes would exert a stronger impact. In this sense, the only two available examples in mice concluded that pathological mutations are selectively eliminated through germline transmission (Fan et al., 2008; Stewart et al., 2008). In both mouse models a similar, but not identical, nuclear back- ground was used. The report from Wallace’s laboratory (Fan et al., 2008) used mouse female ESC line CC9.3.1 isolated from 129SvEv-Gpilc embryo (129 mice are wild type for NNT and SCAF1113). ESCs harboring the mutant mtDNA were injected in C57BL/6NHsd female blastocysts and transferred into pseudo- pregnant females. After that, female chimeras were identified and mated with C57BL6/J males (NNTKO, SCAF1111). Therefore, although the genotype for these two genes is uncertain, they should shift to NNTKO, SCAF1111 with subsequent crosses, a ge- netic context that may enhance mother-to-offspring segregation. Interestingly, they reported that the severe mutation that they fol- lowed in heteroplasmy (ND6 frameshift) completely disappears in subsequent litters of the same female and in along two or three generations (Fan et al., 2008). The report from Stewart and co- workers investigated the fate of mtDNA mutations generated in the mtDNA-mutator mice were the functional gamma-pol was restored (Stewart et al., 2008). All the studies were performed in the C57BL/6N background (NNTWT and SCAF1111) the nuclear context in which we found themore efficient segregation between mother-to-offspring mtDNA transmission. It is in this context where Stewart and co-workers found a very strong selection against missense mutations. In contrast to the studies in mice, selective elimination of the defective mtDNA in humans does not always operate. An array of behaviors from random drift to positive or negative selection for the mutated mtDNA was documented (Otten et al., 2018). We propose that differences in nuclear background may be responsible for this discrepancy between mice and humans and that further studies in mouse models should be performed to evaluate this issue. The relationship between mitochondrial ROS and hetero- plasmy has been previously highlighted (H€am€al€ainen et al., 2013). Thus, elevated levels of H2O2 production by mitochondria caused by elevated mtDNA mutagenesis, disrupted cellular redox signaling and, as a consequence of that, reduced pluripo- tent stem cell reprogramming efficiency and self-renewal capac- ity (H€am€al€ainen et al., 2015). On the other hand, iPSC generation from human patients harboring elevated levels of the 3,243 com- mon MELAS mutation induced a drastic selective response against heteroplasmy (H€am€al€ainen et al., 2013). Both observa- tions are consistent with those reported here and reinforce the relevance of mitochondrial mediated ROS signaling and its sensitivity to mtDNA variations or mutations. Thus, the use of an- tioxidants (NAC) or a genetic nuclear background were mito- chondrial ROS handling is impaired (lack of NNT), obliterate the specific ROS signal that drives the differentiation between NZB and C57 mtDNA haplotypes. In the same line of thought, 8 Cell Metabolism 30, 1–11, November 5, 2019 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 part of the effects induced by the recovery of the wild-type version of SCAF1 may be related to its effects in ROS handling, although it has also implication in the adaptation to cell stress (Balsa et al., 2019). The improved understanding of the molecu- lar link between ROS and mtDNA haplotype selection may open an unexplored way to prevent the transmission of mtDNA-linked diseases. By the same token, understanding how mitochondrial quality control and the regulation of OXPHOS dynamics is trans- duced into the molecular mechanisms that drive non-random mtDNA segregation will open the possibility to prevent the maternal transmission of mtDNA-linked diseases. Mitochondria from the sperm enter the oocyte upon fertilization (Cummins, 2000). Two concurrent mechanism guarantee unipa- rental transmission, the active elimination of the paternal mito- chondria (Sato and Sato, 2011; Zhou et al., 2016) and the enor- mous dilution of the paternal mtDNA (100 copies among 200,000 copies). The mechanism of elimination of the sperm mitochondria may ‘‘leak,’’ generating heteroplasmy in mammals (Gyllensten et al., 1991; Zhao et al., 2004), flies (Dokianakis and Ladoukakis, 2014), and also in humans (Luo et al., 2018; Schwartz and Vissing, 2002), but these are considered very rare cases. However, this possibility, together with the potential artificial gen- eration of mtDNA heteroplasmy by novel medical technologies, highlights the relevance to understand the implications and dy- namics of confronting different pairs of human mtDNA variants. Limitations of Study Our study assessed the behavior of two defined mtDNA haplo- types under one homozygote nuclear genetic background. The question of at which extension our observations can be consid- ered frequent within the mtDNA and nDNA genetic context in mammals in general and in humans in particular, may require further confirmation. In this sense, a very recent publication from the group of Chinnery in Cambridge, UK, documented the existence of selective segregation of mtDNA in the human germ- line driven by the nuclear background. They found that this impact is so strong that it can be observed in just one generation (Wei et al., 2019). Therefore, in accordance with this report, the observed nDNA/mtDNA interaction may not be a peculiarity of a given genetic context in mice (C57BL/6) but a general phenom- enon occurring also in human populations. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d KEY RESOURCES TABLE d LEAD CONTACT AND MATERIALS AVAILABILITY d EXPERIMENTAL MODEL AND SUBJECT DETAILS B Animal Models B Cellular Models d METHOD DETAILS B Molecular Confirmation and Quantification of Hetero- plasmy B Padlock Probes B Oocyte Collection B Embryo Collection B Sperm Collection B In Vitro mtDNA Segregation Studies B SeaHorse Analysis B Histological Analysis of the Ovary B Mitochondrial Membrane Potential (MMP) and ROS Assessment in MEFs B Blue Native Gel Electrophoresis B Western Blot B PET-CT in Embryos d QUANTIFICATION AND STATISTICAL ANALYSIS B Heteroplasmy Statistical Analysis B General Statistical Analysis d DATA AND CODE AVAILABILITY SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. cmet.2019.09.007. ACKNOWLEDGMENTS We thank Dr. C. Lo´pez-Otin for the OMA1KO mice; Dra. R. Martı´nez-de- Mena, I. Martinez-Carrascoso, M.M. Mun˜oz-Hernandez, A. Gonzalez- Guerra, E.R. Martı´nez-Jime´nez, and Dr. Concepcio´n Jimenez for technical assistance; M. Cueva and R. A´lvarez for mouse work; and A. Molina-Iracheta and R. Doohan for histology. A.V.L.-V. was supported by fellowship SVP- 2013-068089 from MCIU. I.G.J. thanks ERC StG EvoConBiO, and a Turing fellowship from the Alan Turing Institute. N.J. thanks EP/N014529/1. SAF2017-84494-C2-R and Programa Red Guipuzcoana de Ciencia, Tecno- logı´a e Informacio´n 2018-CIEN-000058-01, and the Basque Government un- der its ELKARTEK research program (ref: KK-2019/00015) to J.R.-C. The work at CIC biomaGUNE was performed under the Maria de Maeztu Units of Excellence Program from the Spanish State Research Agency – Grant No. MDM-2017-0720. This study was supported by grants from the MCNU (SAF2015-65633-R), the EU (UE0/MCA317433), the Biomedical Research Networking Center on Frailty and Healthy Ageing (CIBERFES-ISCiii), and the HFSP agency (RGP0016/2018) to J.A.E. The CNIC is supported by the Instituto de Salud Carlos III (ISCIII), the Ministerio de Ciencia, Innovacio´n y Universidades (MCNU), and the Pro CNIC Foundation, and is a Severo Ochoa Center of Excellence (SEV-2015-0505). AUTHOR CONTRIBUTIONS A.L.-P. and A.V.L.-V. performed most of the mouse and experimental work with the help of R.J.-M. I.G.J. and N.S.J. performed the data analysis and mathematical modeling. J.M.F.-T. and L.M.C. generated the heteroplasmic animals. A.V.L.-V., J.P., and J.R.-C. performed and analyzed the in vivo imag- ing data. J.L. provided the radiotracers. R.H.H. and A.S. contributed to the generation and analysis of the iPSC and commented on the manuscript. A.G., C.C., R.S., and M.T. contributed to the embryo manipulation and anal- ysis. J.A.E., A.L.-P., and A.V.L.-V. participated in the design of the experi- mental work, the integrated analysis of the results, and the writing of themanu- script. J.A.E. directed and designed the research. DECLARATION OF INTERESTS The authors declare no competing interests. Received: January 22, 2019 Revised: June 12, 2019 Accepted: September 10, 2019 Published: October 3, 2019 REFERENCES Balsa, E., Soustek, M.S., Thomas, A., Cogliati, S., Garcı´a-Poyatos, C., Martı´n- Garcı´a, E., Jedrychowski, M., Gygi, S.P., Enriquez, J.A., and Puigserver, P. Cell Metabolism 30, 1–11, November 5, 2019 9 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 (2019). ER and nutrient stress promote assembly of respiratory chain super- complexes through the PERK-eIF2a axis. Mol. Cell 74, 877–890.e6. Burgstaller, J.P., Johnston, I.G., Jones, N.S., Albrechtova´, J., Kolbe, T., Vogl, C., Futschik, A., Mayrhofer, C., Klein, D., Sabitzer, S., et al. (2014). MtDNA segregation in heteroplasmic tissues is common in vivo and modulated by haplotype differences and developmental stage. Cell Rep. 7, 2031–2041. Burgstaller, J.P., Kolbe, T., Havlicek, V., Hembach, S., Poulton, J., Pia´lek, J., Steinborn, R., R€ulicke, T., Brem, G., Jones, N.S., et al. (2018). Large-scale ge- netic analysis reveals mammalian mtDNA heteroplasmy dynamics and vari- ance increase through lifetimes and generations. Nat. Commun. 9, 2488. Carelli, V., Maresca, A., Caporali, L., Trifunov, S., Zanna, C., and Rugolo, M. (2015). Mitochondria: biogenesis and mitophagy balance in segregation and clonal expansion of mitochondrial DNA mutations. Int. J. Biochem. Cell Biol. 63, 21–24. Cogliati, S., Calvo, E., Loureiro, M., Guaras, A.M., Nieto-Arellano, R., Garcia- Poyatos, C., Ezkurdia, I., Mercader, N., Va´zquez, J., and Enriquez, J.A. (2016). Mechanism of super-assembly of respiratory complexes III and IV. Nature 539, 579–582. Corroyer-Dulmont, A., Chakhoyan, A., Collet, S., Durand, L., MacKenzie, E.T., Petit, E., Bernaudin, M., Touzani, O., and Valable, S. (2015). Imagingmodalities to assess oxygen status in glioblastoma. Front. Med. (Lausanne) 2, 57. Craven, L., Tuppen, H.A., Greggains, G.D., Harbottle, S.J., Murphy, J.L., Cree, L.M., Murdoch, A.P., Chinnery, P.F., Taylor, R.W., Lightowlers, R.N., et al. (2010). Pronuclear transfer in human embryos to prevent transmission of mito- chondrial DNA disease. Nature 465, 82–85. Cuezva, J.M., Chen, G., Alonso, A.M., Isidoro, A., Misek, D.E., Hanash, S.M., and Beer, D.G. (2004). The bioenergetic signature of lung adenocarcinomas is a molecular marker of cancer diagnosis and prognosis. Carcinogenesis 25, 1157–1163. Cummins, J.M. (2000). Fertilization and elimination of the paternal mitochon- drial genome. Hum. Reprod. 15, 92–101. Dı´ez-Sa´nchez, C., Ruiz-Pesini, E., Montoya, J., Pe´rez-Martos, A., Enrı´quez, J.A., and Lo´pez-Pe´rez,M.J. (2003). Mitochondria from ejaculated human sper- matozoa do not synthesize proteins. FEBS Lett. 553, 205–208. Dokianakis, E., and Ladoukakis, E.D. (2014). Different degree of paternal mtDNA leakage between male and female progeny in interspecific Drosophila crosses. Ecol. Evol. 4, 2633–2641. Fan, W., Waymire, K.G., Narula, N., Li, P., Rocher, C., Coskun, P.E., Vannan, M.A., Narula, J., Macgregor, G.R., and Wallace, D.C. (2008). A mouse model of mitochondrial disease reveals germline selection against severe mtDNA mutations. Science 319, 958–962. Grimes, D.R., Warren, D.R., andWarren, S. (2017). Hypoxia imaging and radio- therapy: bridging the resolution gap. Br. J. Radiol. 90, 20160939. Guara´s, A., Perales-Clemente, E., Calvo, E., Acı´n-Pere´z, R., Loureiro-Lopez, M., Pujol, C., Martı´nez-Carrascoso, I., Nun˜ez, E., Garcı´a-Marque´s, F., Rodrı´guez-Herna´ndez, M.A., et al. (2016). The CoQH2/CoQ ratio serves as a sensor of respiratory chain efficiency. Cell Rep. 15, 197–209. Gyllensten, U., Wharton, D., Josefsson, A., and Wilson, A.C. (1991). Paternal inheritance of mitochondrial DNA in mice. Nature 352, 255–257. H€am€al€ainen, R.H., Manninen, T., Koivum€aki, H., Kislin, M., Otonkoski, T., and Suomalainen, A. (2013). Tissue- and cell-type-specificmanifestations of heter- oplasmic mtDNA 3243A>G mutation in human induced pluripotent stem cell- derived disease model. Proc. Natl. Acad. Sci. U S A 110, E3622–E3630. H€am€al€ainen, R.H., Ahlqvist, K.J., Ellonen, P., Lepisto¨, M., Logan, A., Otonkoski, T., Murphy, M.P., and Suomalainen, A. (2015). mtDNA mutagen- esis disrupts pluripotent stem cell function by altering redox signaling. Cell Rep. 11, 1614–1624. Jenuth, J.P., Peterson, A.C., Fu, K., and Shoubridge, E.A. (1996). Random ge- netic drift in the female germline explains the rapid segregation of mammalian mitochondrial DNA. Nat. Genet. 14, 146–151. Johnston, I.G., Burgstaller, J.P., Havlicek, V., Kolbe, T., R€ulicke, T., Brem, G., Poulton, J., and Jones, N.S. (2015). Stochastic modelling, Bayesian inference, and new in vivo measurements elucidate the debated mtDNA bottleneck mechanism. eLife 4, e07464. Johnston, I.G., and Jones, N.S. (2016). Evolution of cell-to-cell variability in stochastic, controlled, heteroplasmic mtDNA populations. Am. J. Hum. Genet. 99, 1150–1162. Johnston, I.G., Gaal, B., Neves, R.P.D., Enver, T., Iborra, F.J., and Jones, N.S. (2012). Mitochondrial variability as a source of extrinsic cellular noise. PLoS Comput. Biol. 8, e1002416. Jokinen, R., Marttinen, P., Stewart, J.B., Neil Dear, T., and Battersby, B.J. (2016). Tissue-specific modulation of mitochondrial DNA segregation by a defect in mitochondrial division. Hum. Mol. Genet. 25, 706–714. Kang, E., Wu, J., Gutierrez, N.M., Koski, A., Tippner-Hedges, R., Agaronyan, K., Platero-Luengo, A., Martinez-Redondo, P., Ma, H., Lee, Y., et al. (2016). Mitochondrial replacement in human oocytes carrying pathogenic mitochon- drial DNA mutations. Nature 540, 270–275. Lapuente-Brun, E., Moreno-Loshuertos, R., Acı´n-Pe´rez, R., Latorre-Pellicer, A., Cola´s, C., Balsa, E., Perales-Clemente, E., Quiro´s, P.M., Calvo, E., Rodrı´guez-Herna´ndez, M.A., et al. (2013). Supercomplex assembly deter- mines electron flux in the mitochondrial electron transport chain. Science 340, 1567–1570. Latorre-Pellicer, A., Moreno-Loshuertos, R., Lechuga-Vieco, A.V., Sa´nchez- Cabo, F., Torroja, C., Acı´n-Pe´rez, R., Calvo, E., Aix, E., Gonza´lez-Guerra, A., Logan, A., et al. (2016). Mitochondrial and nuclear DNA matching shapes metabolism and healthy ageing. Nature 535, 561–565. Lee, H.S., Ma, H., Juanes, R.C., Tachibana, M., Sparman, M., Woodward, J., Ramsey, C., Xu, J., Kang, E.J., Amato, P., et al. (2012). Rapid mitochondrial DNA segregation in primate preimplantation embryos precedes somatic and germline bottleneck. Cell Rep. 1, 506–515. Luo, S., Valencia, C.A., Zhang, J., Lee, N.C., Slone, J., Gui, B., Wang, X., Li, Z., Dell, S., Brown, J., et al. (2018). Biparental inheritance of mitochondrial DNA in humans. Proc. Natl. Acad. Sci. U S A 115, 13039–13044. Moreno-Loshuertos, R., Acı´n-Pere´z, R., Ferna´ndez-Silva, P., Movilla, N., Pe´rez-Martos, A., Rodrı´guez de Co´rdoba, S., Gallardo, M.E., and Enrı´quez, J.A. (2006). Differences in reactive oxygen species production explain the phe- notypes associated with common mouse mitochondrial DNA variants. Nat. Genet. 38, 1261–1268. Otten, A.B.C., Sallevelt, S.C.E.H., Carling, P.J., Dreesen, J.C.F.M., Dr€usedau, M., Spierts, S., Paulussen, A.D.C., de Die-Smulders, C.E.M., Herbert, M., Chinnery, P.F., et al. (2018). Mutation-specific effects in germline transmission of pathogenic mtDNA variants. Hum. Reprod. 33, 1331–1341. Picard, M., McManus, M.J., Gray, J.D., Nasca, C., Moffat, C., Kopinski, P.K., Seifert, E.L., McEwen, B.S., and Wallace, D.C. (2015). Mitochondrial functions modulate neuroendocrine, metabolic, inflammatory, and transcriptional re- sponses to acute psychological stress. Proc. Natl. Acad. Sci. U S A 112, E6614–E6623. Piko´, L., and Taylor, K.D. (1987). Amounts of mitochondrial DNA and abun- dance of some mitochondrial gene transcripts in early mouse embryos. Dev. Biol. 123, 364–374. Quiro´s, P.M., Ramsay, A.J., Sala, D., Ferna´ndez-Vizarra, E., Rodrı´guez, F., Peinado, J.R., Ferna´ndez-Garcı´a, M.S., Vega, J.A., Enrı´quez, J.A., Zorzano, A., et al. (2012). Loss of mitochondrial protease OMA1 alters processing of the GTPase OPA1 and causes obesity and defective thermogenesis in mice. EMBO J. 31, 2117–2133. Ronchi, J.A., Figueira, T.R., Ravagnani, F.G., Oliveira, H.C.F., Vercesi, A.E., and Castilho, R.F. (2013). A spontaneous mutation in the nicotinamide nucle- otide transhydrogenase gene of C57BL/6J mice results in mitochondrial redox abnormalities. Free Radic. Biol. Med. 63, 446–456. Sato, M., and Sato, K. (2011). Degradation of paternal mitochondria by fertil- ization-triggered autophagy in C. elegans embryos. Science 334, 1141–1144. Schwartz, M., and Vissing, J. (2002). Paternal inheritance of mitochondrial DNA. N. Engl. J. Med. 347, 576–580. Sharpley, M.S., Marciniak, C., Eckel-Mahan, K., McManus, M., Crimi, M., Waymire, K., Lin, C.S., Masubuchi, S., Friend, N., Koike, M., et al. (2012). Heteroplasmy of mouse mtDNA is genetically unstable and results in altered behavior and cognition. Cell 151, 333–343. 10 Cell Metabolism 30, 1–11, November 5, 2019 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 Shirihai, O.S., Song, M., and Dorn, G.W. (2015). Howmitochondrial dynamism orchestrates mitophagy. Circ. Res. 116, 1835–1849. Stewart, J.B., Freyer, C., Elson, J.L., Wredenberg, A., Cansu, Z., Trifunovic, A., and Larsson, N.G. (2008). Strong purifying selection in transmission of mammalian mitochondrial DNA. PLoS Biol. 6, e10. Tachibana, M., Sparman, M., Sritanaudomchai, H., Ma, H., Clepper, L., Woodward, J., Li, Y., Ramsey, C., Kolotushkina, O., and Mitalipov, S. (2009). Mitochondrial gene replacement in primate offspring and embryonic stem cells. Nature 461, 367–372. Treuting, P.M., Dintzis, S.M., and Montine, K.S. (2017). Comparative Anatomy and Histology (Academic Press). Wai, T., Teoli, D., and Shoubridge, E.A. (2008). The mitochondrial DNA genetic bottleneck results from replication of a subpopulation of genomes. Nat. Genet. 40, 1484–1488. Warren, D.R., and Partridge, M. (2016). The role of necrosis, acute hypoxia and chronic hypoxia in 18F-FMISOPET image contrast: a computational modelling study. Phys. Med. Biol. 61, 8596–8624. Wartiovaara, A., and Syv€anen, A.C. (2002). Analysis of nucleotide sequence variations by solid-phase minisequencing. Methods Mol. Biol. 187, 57–63. Wei, W., Tuna, S., Keogh, M.J., Smith, K.R., Aitman, T.J., Beales, P.L., Bennett, D.L., Gale, D.P., Bitner-Glindzicz, M.A.K., Black, G.C., et al. (2019). Germline selection shapes human mitochondrial DNA diversity. Science 364, eaau6520. Wittig, I., Braun, H.P., and Sch€agger, H. (2006). Blue native PAGE. Nat. Protoc. 1, 418–428. Woltjen, K., H€am€al€ainen, R., Kibschull, M., Mileikovsky, M., and Nagy, A. (2011). Transgene-free production of pluripotent stem cells using piggyBac transposons. Methods Mol. Biol. 767, 87–103. Woods, D.C., and Tilly, J.L. (2015). Autologous germline mitochondrial energy transfer (AUGMENT) in human assisted reproduction. Semin. Reprod. Med. 33, 410–421. Yamada, M., Emmanuele, V., Sanchez-Quintero, M.J., Sun, B., Lallos, G., Paull, D., Zimmer, M., Pagett, S., Prosser, R.W., Sauer, M.V., et al. (2016). Genetic drift can compromise mitochondrial replacement by nuclear transfer in human oocytes. Cell Stem Cell 18, 749–754. Zhao, X., Li, N., Guo, W., Hu, X., Liu, Z., Gong, G., Wang, A., Feng, J., and Wu, C. (2004). Further evidence for paternal inheritance ofmitochondrial DNA in the sheep (Ovis aries). Heredity (Edinb) 93, 399–403. Zhou, Q., Li, H., Li, H., Nakagawa, A., Lin, J.L.J., Lee, E.S., Harry, B.L., Skeen- Gaar, R.R., Suehiro, Y., William, D., et al. (2016). Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization. Science 353, 394–399. Cell Metabolism 30, 1–11, November 5, 2019 11 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies NDUFA9 Abcam Ab14713 COI Invitrogen 459600 UQCRC2 (Core2) ProteinTech 14742-I-AP SDHA ThermoFisher 459200 GAPDH Abcam Ab8245 ATPB Abcam Ab14730 Mouse IgG (H+L) DyLight 800 Rockland 610-145-002 Mouse IgG (H+L) Alexa Fluor 680 Invitrogen A21057 Rabbit IgG (H+L) DyLight 800 Rockland 611-145-122 Chemicals, Peptides, and Recombinant Proteins F29 DNA polymerase New England Biolabs M0269L BamH1 New England Biolabs R0136M SspI New England Biolabs R0132S Lambda Exonuclease. New England Biolabs M0262S T4 DNA ligase New England Biolabs M0202M TMRM ThermoFisher T668 H2DCFDA ThermoFisher D399 Digitonin Sigma-Aldrich D5628 [18F]-FMISO This Paper N/A [18F]-FDG This Paper N/A N-Acetyl-L-cysteine Sigma-Aldrich A7250 Critical Commercial Assays kit 5Prime Master Mix 5Prime 2200200 DNeasy Blood &Tissue kit Qiagen 69506 Dulbecco’s modified Eagle’s medium Gibco 41966029 Seahorse XFe96 FluxPaks Agilent 102416-100 CyQUANT NF Cell Proliferation Assay Kit ThermoFisher C35006 PVDF transfer membrane Immobilon-FL Merck Millipore IPFL00010 SEA BLOCK Blocking buffer ThermoFisher 37527 Neon Trasfection System 100ml kit Invitrogen MPK10025 Vector Red Alkaline Phosphatase (Red AP) Substrate Kit Vector Laboratories SK-5100 Experimental Models: Organisms/Strains C57BL/6JOlaHsd Envigo N/A CD1 Charles River Laboratories N/A C57BL/6J The Jackson Laboratories 000664 Oligonucleotides Mouse 3862-3884 (Fw) 5’-AAGCTATCGGG CCCATACCCCG-3’ This Paper N/A Mouse 4503-4525 (Rv) 5’-GTTGAGTAGAGT GAGGGATGGG-3’ This Paper N/A ppC57 probe -P- ATTACTCTCTTCTGG TTCCTTTTACGA CCTCAATGCTGCTGCTGTACTACTCTTC ACAGTGTACA GGTTA -3’ This Paper N/A (Continued on next page) e1 Cell Metabolism 30, 1–11.e1–e5, November 5, 2019 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 LEAD CONTACT AND MATERIALS AVAILABILITY Request of information and material should be made to Jose´ Antonio Enriquez. Mouse and cell lines generated in this study are available upon request for a non-commercial use under a Material Transfer agreement. EXPERIMENTAL MODEL AND SUBJECT DETAILS This study used mouse and cellular models which were generated from the animals. Animal Models Mice were kept in standard housing conditions in a specific pathogen free (SPF) status facility on a 12-hour light/dark cycle at 20-24C and relative humidity at 45-65%. Themaintenance conditions are checked and registered daily. All animal procedures conformed to EU Directive 86/609/EEC and Recommendation 2007/526/EC regarding the protection of animals used for experimental and other scien- tific purposes, enforced in Spanish law under RD 1201/2005 and RD 53/2013. Approval of the different experimental protocols requires the estimation of adequate sample sizes aswell as the definition of the randomization and blinding criteria.Mice received ad libitum food and water (5K67 LabDiet) and the number of mice per cage is limited and adapted to RD 53/2013. Experiments were carried out with males and females indistinctively, and the details of the age of themice can be found in the figure legends and results. C57BL/6JOlaHsd andCD-1wild-typemicewerepurchased fromEnvigo andCharlesRiver Laboratories respectively, and themicewithC57BL/6J nuclear background were from The Jackson Laboratory. The conplastic mouse strain with C57BL/6 nuclear genome and the NZB/OlaHsd mtDNA was described before (Latorre-Pellicer et al., 2016). OMA1KO mice on the C57BL/6JOlaHsd background, were generated as described in Quiro´s et al. (2012). Heteroplasmic mice were generated by electro-fusing cytoplasts from conplastic BL/6NZB zygotes to recipient C57BL/6JOlaHsd (BL/6C57) one-cell embryos, cultured overnight and transplanted as two-cell embryos into pseudo preg- nant Hsd:ICR (CD-1) females to complete development to term as previously described (Jenuth et al., 1996). To the best of our knowl- edge, no consensus rule to name heteroplasmic mouse strains exists. Here, we propose the following designation to name heteroplas- mic mouse strains: NUCLEAR GENOME- - mtCYTOPLASMIC GENOME #1 + CYTOPLASMIC GENOME #2 [i.e., C57BL/6-mtC57BL/ 6+NZB, a strain with the nuclear genome of C57BL/6JOlaHsd and the cytoplasmic (mitochondrial) genome of C57BL/6JOlaHsd and NZB/B1NJ]. For simplicity, we label this BL/6C57-NZB throughout this report. Heteroplasmic females (BL/6C57-NZB) were outcrossed with males BL/6C57. Only females with an initial level of mtDNA NZB heteroplasmy above 20% were used for colony maintenance. To produce heteroplasmic mice OMA1KO, BL/6C57-NZB female were outcrossed to male OMA1KO (C57BL/6JOlaHsd background) to generate an F1 heterozygote mice, which were then intercrossed to obtain a F2 OMA1KO heteroplasmic mice. Oma1 was genotyped as described (Quiro´s et al., 2012). To produce heteroplasmic mice NNTKO, BL/6C57-NZB females were outcrossed with NNTKO males (C57BL/6J background) to generate the F1 heterozygote mice, which were then intercrossed to obtain the F2 NNTKO heteroplasmic mice. Heteroplasmic strains were maintained by outcrossing heteroplasmic females (BL/6C57-NZB NNTKO) with BL/6C57 NNTKO males. Nnt was genotyped as described in Ronchi et al. (2013). To produce heteroplasmic mice SCAF1113, BL/6C57-NZB females were out- crossed to SCAF1113 males (C57BL/6JOlaHsd nuclear background) to generate the F1 heterozygote mice, which were then inter- crossed to obtain the F2 SCAF1113 heteroplasmic mice. Heteroplasmic strains were maintained by outcrossing heteroplasmic females (BL/6C57-NZB SCAF1113) with BL/6C57 SCAF1113 males. Scaf1 was genotyped as described in Cogliati et al. (2016). Continued REAGENT or RESOURCE SOURCE IDENTIFIER ppNZB probe 5’-P- ATTACTCTCTTCTGGCCTTTCC TACGACCTCAATGCACATGTTTGGCTCCTCTTCAC AGTGTACAGGTTC -3’ This Paper N/A Lin33 (ppC57) 5’-Cy3-CCTCAATGCTGCTGCTGTACTAC-3’ This Paper N/A Lin16 (ppNZB) 5’-FITC-CCTCAATGCACATGTTTGGCTCC-3’; 5’-Cy5-CCTCAATGCACATGTTTGGCTCC-3’ This Paper N/A Software and Algorithms GraphPad Prism Version 6 GraphPad Software N/A ImageJ v.1.6.0 NIH N/A NDP view2 Software Hamamatsu Photonics U12388-01 FACSDiva Software BD Biosciences N/A FlowJo FlowJo LLC, BD Biosciences N/A Cell Metabolism 30, 1–11.e1–e5, November 5, 2019 e2 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 Cellular Models Mouse embryo fibroblast (MEF) cell lines were isolated from 13.5 dpc from both sexes of embryos using standard protocol. Each embryo was dissected into 10ml of sterile PBS, voided of its internal organs, head, and legs. After 30 min incubation with gentle shaking at 37C with 5ml 0,1% trypsin, cells were plated in two 100 mm dishes and incubated for 24-48h. All MEFs used for iPSCs studies were within the first three passages. To establish the immortalized MEF lines, early passage MEFs were seeded in 60 mm plates and infected with 105 IU/ml packaged retrovirus E6/E7. Selection was performed with 400 mg/ml of G418 during 10 days. IPSCs were generated using transposon-mediated gene transfer (Woltjen et al., 2011). The transfections were done using a Neon electroporator (Invitrogen; one pulse; 30 mS; 1,300 V) and Neon Trasfection System 100ml kit (Invitrogen) with 2 mg of DNA and 2.5 x 105 cells per electroporation. The culture media was supplemented with 1.5 mg/ml of doxycycline on the next day. For reprog- ramming in different oxygen tensions, electroporations were split into two separate plates: one cultured in 4%O2 (Biospherix ExVivo chamber) and the other cultured in a standard room-air incubator of around 21% O2. For reprogramming in different medium con- ditions in 21% O2, the electroporations were split into two separate plates: one cultured with standard medium, and the other sup- plemented with 1 mMNAC (Sigma). To assess the reprogramming efficiency, plates were stained on day 14 for alkaline phosphatase (AP) activity (Vector RedAlkaline Phosphate substrate kit). The relative reprograming efficiencywas defined as the proportion of num- ber of iPSC clones generated from identical MEFs number, compared to a reference of 100 defined as the proportion obtained with BL/6C57 MEFs under 21% Oxygen concentration. METHOD DETAILS Molecular Confirmation and Quantification of Heteroplasmy To determine the heteroplasmy levels of each tissue or cell culture, total genomic DNA was isolated using DNeasy Blood &Tissue kit (Qiagen). The polymorphic G4276A nucleotide was used to genotype individual animals and tissues. This polymorphism in C57 mtDNA forms part of a BamH1 restriction site, which is absent in NZBmtDNA. Total genomic DNAwas PCR amplified using standard conditions with the kit 5Prime Master Mix (5Prime) and the following primers: 5’-AAGCTATCGGGCCCATACCCCG-3’ (3862-3884) and 5’-GTTGAGTAGAGTGAGGGATGGG-3’ (4503-4525), as follow: 95C, 30s; 58C, 30s; 72C, 45s for 30 cycles. A 15 ml aliquot of PCR was digested with 20 units of BamH1 (New England Biolabs), at 37C for 2 hours. After agarose gel electrophoresis, DNA was visualized using the Gel Doc XR+System (Bio-Rad), and band intensities were quantified with Quantity One 1-D Analysis Software. The proportion of C57 mtDNA was calculated by adding the intensities of the 414bp and 250bp BamH1-digested frag- ments and was divided by the sum of the intensities of the undigested 664bp fragments and the 414bp and 250bp BamH1-digested fragments. Wemonitored it by PCR amplification followed by BamHI digestion to differentiate the twomtDNAs (C57 uncut, NZB cut). normal room air of around 21%O2 To correct for potential bias in the estimation of the heteroplasmy, we used standard curves gener- ated by mixing pure mutant and wildtype DNAs. We confirm the accuracy of our heteroplasmy estimation by PCR and solid-phase minisequencing (Wartiovaara and Syv€anen, 2002). Padlock Probes Cells were seeded in Superfrost plus slides (Thermo Scientific) using complete DMEM media lacking phenol-red (10% FBS, 290 mg/mL L-glutamine, 50 mg/mL uridine, 5 mM glucose) and allowed to attach. When the cells reached 80% of confluency they were fixed in 4% (w/v) paraformaldehyde (Sigma) in DMEMmedia for 15 minutes at 37C. Cell permeabilization was performed using 95%EtOH and 5%acetic acid for 10minutes at RT. Slides were thenwashedwith PBS. Enzymatic target preparation was performed with SspI (New Engalnd Biolabs R0132S) for 30 minutes at 37C. Two washes were done with Buffer A (0.1M Tris-HCl pH 7.5, 0.15 M NaCl and 0.05%Tween-20). 0.2 U/mL of Lambda-exonuclease (New England BiolabsM0262S) was used for 15minutes at 37C add- ing 10% glycerol to the corresponding enzyme buffer. The slides were washed twice with Buffer A. Oligonucleotide sequences were designed (Table S2). Padlock probes (ppC57 and ppNZB) were incubated in a specific hybridization buffer (2X saline-sodium citrate (SSC) buffer, 20% formamide, 0.5 mg/mL salmon spermDNA) for 15minutes at 37C. To remove excess probe, Buffer B was used (2X SSC, 0.05% Tween-20) for 5 minutes at 37C. DNA padlock probes were circularized by T4 DNA ligase (New England Biolabs M0202M) for 15 minutes at 42C in Buffer B supplemented with 20% formamide and 1 mM EDTA. Slides were then washed in Buffer A and dehydrated in ethanol. RCA was performed using 1U/ mL ofF29 DNA polymerase (New England Biolabs M0269L) for 1 hour at 37C in a shaking platform. Slides were washed three times with Buffer A and Lin16 and Lin33 fluorescence-labelled oligonucleotide (100 nM) hybridization was performed in the hybridization buffer for 30 minutes at 37C. Slides were then washed with Buffer A fol- lowed by PBS-0.01% Tween-20 and dehydrated in ethanol. Vectashield with DAPI mounting media were used for nuclei staining. Specificity of the probes and staining were confirmed by using homoplasmic cell cultures (100%NZB and 100%C57 mtDNA). Leica SP5 confocal and ImageJ v.1.6.0 software was used for image acquisition and data analysis respectively. Oocyte Collection Heteroplasmic female mice were superovulated by intraperitoneal administration of 5 IU PMSG (Sigma) to stimulate follicle growth. A single intraperitoneal injection of 5 IU hCG (Sigma) was followed 48 hr later. 16 hr after the hCG injection, mice were euthanized by cervical dislocation and the oviducts dissected out. Ovulated oocytes were collected from the ampullae of the oviducts and placed individually in a 0,2ml sterile tube for genotyping. Ovaries were collected to quantify heteroplasmy. e3 Cell Metabolism 30, 1–11.e1–e5, November 5, 2019 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 Embryo Collection Heteroplasmic females werematedwith BL/6C57males. The presence of a vaginal plugwas taken as evidence of pregnancy, and 2.5, 5.5, 6.5, 13.5 and 17.5 dpc embryos were collected for genotyping. When indicated, females were treated with 1% NAC in drinking water since vaginal plug was detected. Sperm Collection Male mice that had not been mated for more than 2 weeks were euthanized and sperm was collected from the epididymis. In Vitro mtDNA Segregation Studies Immortalized MEFS were grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco without glucose) supplemented with 10% fetal bovine serum (FBS; Sigma), 1% Penicillin-Streptomycin (Lonza) and 1mM sodium pyruvate (Sigma). Where indicated, the carbon source was: 4.5g/l of glucose (Sigma), 0.9g/l of glucose or 0.9g/l of galactose (Sigma). SeaHorse Analysis Oxygen consumption was measured using the XF96 MitoStress Test (Seahorse Bioscience). Oxygen consumption rates were normalized to cell number using CyQuant (ThermoFisher Scientific). Histological Analysis of the Ovary Ovaries were collected from homoplasmic and heteroplasmic females, fixed with 4% PFA for 24 hours and sectioned at 5 mm. Four sections from each ovary at three different levels of the tissue (40 mm between each section was discarded) were processed, mounted on a glass slide, stained with H&E and digitalized using NDP view2 Software. Ovaries from females of 3, 6, 9, and 12months of age were analyzed using ImageJ v.1.6.0 Software (NIH) to assess the percentage of lipofuscin in ovaries. Classification of primor- dial follicle, primary follicle and growing follicle was done according to Treuting P. and Dintzis S (Treuting et al., 2017). Mitochondrial Membrane Potential (MMP) and ROS Assessment in MEFs ROS and MMP were measured in MEFs using 20-70dichlorofluorescein diacetate (H2DCFDA, ThermoFisher, 0.4mM final concentra- tion), and tetramethylrhodamine methyl ester perchlorate (TMRM, Sigma, 100 nM final concentration). A total of 10.000 events were recorded for each sample using the FACSCanto II system (BD Biosciences). All experiments were performed in triplicate. Samples were analyzed with BD FACSDiva Software and an average of the means and standard deviations were calculated using FlowJo Software (v10). Blue Native Gel Electrophoresis Supercomplex levels and compositions were analyzed in isolatedmitochondria from 12.5 dpc embryos using blue native electropho- resis (BNE) as described previously (Wittig et al., 2006). Mitochondrial proteins were solubilized with 10% digitonin (4g/g) (Sigma D5628) and run on a 3%–13% gradient gel. The gradient gel was prepared in 1.5 mm glass plates using a gradient former connected to a peristaltic pump. Proteins were electroblotted onto PVDF transfer membrane (Immobilon-FL, 0.45 mm, Merck millipore, IPFL00010) for 1 h at 100 V in transfer buffer (48 mM Tris, 39 mM glycine, 20 % EtOH). A Mini Trans- Blot Cell system (BioRad) was used. SEA BLOCK Blocking buffer (ThermoFisher 37527) or PBS with 5 % BSA was used for 1 hour at room temperature (RT) to avoid non-specific binding of antibodies. For protein detection, antibodies were incubated with the membrane for 2 hours at RT. Secondary antibodies were incubated for 45 minutes at RT. The membrane was washed with PBS 0.1 % Tween-20 for 5 mi- nutes three times between primary and secondary antibodies and after secondary antibodies. To study supercomplex assembly, the PVDFmembranewas sequentially probedwith antibodies against Complex I (anti-NDUFA9), Complex III (anti-UQCRC2), Complex IV (anti-COI), Complex V (anti-ATPB) and Complex II (anti-SDHA) (Table S1). Western Blot Proteins in whole embryo lysates were separated using SDS/PAGE and transferred to PVDF membranes (Immobilon-FL, 0.45 mm, Merck millipore, IPFL00010), which were then blocked with 5% (vol/vol) BSA in 0.1 % Tween 20 in PBS for 1 h at room temperature. The membranes were then probed using anti-GAPDH (mouse monoclonal, Abcam, Ab8245), and anti-ATPB (mouse monoclonal Abcam, Ab14730). The secondary antibody was anti-mouse dylight 800 (Rockland, 610145002) and the images were acquired using the ODYSSEY Infrared Imaging System (LI-COR). Protein quantification was performed using ImageJ v.1.6.0 software. PET-CT in Embryos In vivo positron emission tomography–computed tomography (PET/CT) imaging was performed with a nanoPET/CT small-animal im- aging system (Mediso Medical Imaging Systems, Budapest, Hungary). List-mode PET data acquisition commenced 30 min post intra- venous injection of 18MBq [18F]- FDG or 30MBq [18F]-fluoromisonidazole ([18F]-FMISO) in 12.5 dpc embryo imaging, and continued for 20 minutes of PET acquisition. At the end of PET acquisitions, scan microCT was performed for attenuation correction and anatomical references. The resulting dynamic PET imageswere reconstructed in a 105 x 105matrix (frame rates: 3 x 10min, 1 x 30min, 1 x 60min) using a Tera-Tomo 3D iterative algorithm. Acquisition and reconstruction were performed with proprietary Nucline software (Mediso, Budapest, Hungary) and saved in Dicom format. The images were imported into OsiriX software (Pixmeo, Switzerland v.8.0.1). Cell Metabolism 30, 1–11.e1–e5, November 5, 2019 e4 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007 Biodistribution studieswere performed in aWizard 1470GammaCounter (Perkin Elmer). The pregnant femaleswere sacrificed in a CO2 chamber. Embryoswere extracted and counted for 1min in the gammacounter. Decay correctionwas performed and data represented as relative %ID/ g. QUANTIFICATION AND STATISTICAL ANALYSIS Heteroplasmy Statistical Analysis Themagnitude of heteroplasmy shifts under constant selective pressure depends on heteroplasmy levels, so percentage-point shifts observed in mice with different initial heteroplasmies cannot be directly compared. For example, for the same selective pressure, smaller percentage-point shifts are expected as the limits of 0% and 100% are approached. To allow comparison of heteroplasmy shifts across diverse samples, we use a transformation that accounts for the heterogeneity in expected shift magnitude from a given selective pressure. This transformation (Burgstaller et al., 2014; Johnston and Jones, 2016) is Dh = ln ((h (h0 – 1)) / (h0 (h – 1))), comparing a heteroplasmy observation h to a reference value h0. Depending on scientific context, h0 may be a sample taken earlier in time, or from a reference tissue: we specify the source of the corresponding reference value in the main text. Dh, the transformed heteroplasmy shift, then reports a normalised magnitude of heteroplasmy shift that is comparable across samples with differing h0 values. Dh = 0 corresponds to a null hypothesis of no selective difference between mtDNA types. Cross-sample distributions of Dh values for nonzero and zero selection are typically well approximated by Gaussian distributions (Burgstaller et al., 2018). General Statistical Analysis Unless specified, statistical analyses and graphics were produced with GraphPad Prism 6 software. Data sets were compared by ANOVA or non-parametric analysis when corresponded. Differences were considered statistically significant at P values below 0.05. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. All statistical analyses are presented as n, mean ± s.d. or mean ± s.e.m. in the figure legends. DATA AND CODE AVAILABILITY Some of the datasets supporting the current study have not been deposited in a public repository yet, but will be donewhen possible, meanwhile they are available from the corresponding author upon request. e5 Cell Metabolism 30, 1–11.e1–e5, November 5, 2019 Please cite this article in press as: Latorre-Pellicer et al., Regulation of Mother-to-Offspring Transmission of mtDNA Heteroplasmy, Cell Metabolism (2019), https://doi.org/10.1016/j.cmet.2019.09.007